Hackvent started out early with a -1 day released on 29 November. There were seven easy challenges, including -1, one hidden, and five daily challenges. These challenges were heavy in crypto, image editing / steg, and encoding. My favorite in the group was Chinese Animals, where I spent way more figuring out what was going on after solving than actually solving.

HV20.(-1)

Challenge

hv20-ball-1 HV20.-1 Twelve steps of christmas
Categories: funFUN
Level: easy
Author: Bread

IOn the third day of christmas my true love sent to me…

three caesar salads, two to (the) six basic arguments, one quick response.

There’s also an attached message. It has two parts, separated by an empty line:

$ head -5 db47d0fc-3dde-4f97-9362-df01946699d9.txt
Sbopb 3 alkb! Lcc tfqe vlr! Dbq yxzh ql tloh! Vlr'ob klq alkb ebob...

fSYLOt0HDdlXXXXKPReBRdXXXWlXXXDxZXXXXXXQyan/XXXGfUmRTEOPVUzdzEGsWjipWPY0bUYi
FDS4xTVXXEgxoSeyhrP4AcwkHUtBdf+Nu+Bwtgct8W0Gnnlc07sbfUCUiHPfHYYBGeGNr/2ccu/3
I/vCCouITTqmmUg8mWWx6Ifl/s41L4mMaouA/yjPo+MrcPMdEEDL94y2buybwu8MsKxN8UUz1baL
...[snip]...

The base64-encoded looking blob continues for many more lines.

Solution

First Line

The message has two parts. The top line is:

Sbopb 3 alkb! Lcc tfqe vlr! Dbq yxzh ql tloh! Vlr'ob klq alkb ebob...

The top line of the song, “three caesar salads” applies here. The Caesar Cipher involves shifting each letter by a constant number, so for example if the key was three, A –> D, B –> E, C –> F, and Z –> C. When the key is 13, this transform is known as ROT13.

I dumped the message into cyberchef with the ROT13 operation (which offers a key parameter for non-13 keys), and when the key is three (fits the clue), a message pops out:

Verse 3 done! Off with you! Get back to work! You're not done here...

Rest

The rest looks like a base64 encoded blob:

$ head -5 db47d0fc-3dde-4f97-9362-df01946699d9.txt
Sbopb 3 alkb! Lcc tfqe vlr! Dbq yxzh ql tloh! Vlr'ob klq alkb ebob...

fSYLOt0HDdlXXXXKPReBRdXXXWlXXXDxZXXXXXXQyan/XXXGfUmRTEOPVUzdzEGsWjipWPY0bUYi
FDS4xTVXXEgxoSeyhrP4AcwkHUtBdf+Nu+Bwtgct8W0Gnnlc07sbfUCUiHPfHYYBGeGNr/2ccu/3
I/vCCouITTqmmUg8mWWx6Ifl/s41L4mMaouA/yjPo+MrcPMdEEDL94y2buybwu8MsKxN8UUz1baL

The blob doesn’t decode to anything interesting. The first line is the clue, when it says “You’re not done here…”. It is a way to check that I’m successfully applying the first line, but I still need to apply that to the blob.

Switching to the command-line, I’ll use grep to remove the first and empty line, then tr to do that Caesar translation, then base64 to decode. Once I do that, xxd provides a hex dump, which shows the results is a PNG:

$ cat db47d0fc-3dde-4f97-9362-df01946699d9.txt | grep -v -E -e '^$' -e Sbopb | tr 'A-Za-z' 'D-ZA-Cd-za-c' | base64 -d | xxd | head
00000000: 8950 4e47 0d0a 1a0a 0000 000d 4948 4452  .PNG........IHDR
00000010: 0000 019a 0000 019a 0800 0000 0013 6dda  ..............m.
00000020: bf00 0009 897a 5458 7452 6177 2070 726f  .....zTXtRaw pro
00000030: 6669 6c65 2074 7970 6520 6578 6966 0000  file type exif..
00000040: 78da ad58 5b92 e4b8 0dfc e729 7c04 822f  x..X[......)|../
00000050: 90c7 e133 c237 f0f1 9d09 aaaa 1fd3 bbde  ...3.7..........
00000060: 8971 5794 a4a2 2810 4426 1250 bbfd 9f7f  .qW...(.D&.P....
00000070: 1ff7 2ffc 8516 bc4b 596b 69a5 78fc a596  ../....KYki.x...
00000080: 5ae8 b8a8 fefe 353b 8a4f 76bc 43fd b992  Z.....5;.Ov.C...
00000090: afe3 ee7d 23e0 1c71 8ef7 86f6 7b16 decf  ...}#..q....{...

Contrast

After removing xxd and head, and directing the output to a file, the image looks just white:

Still, the last line suggests I should get one quick response (QR). Looking at it in Gimp, I’ll select Color -> Auto -> Stretch Contrast …, and it pops out as a QR Code:

This image contains the flag:

Flag: HV20{34t-sl33p-haxx-rep34t}

HV20.01

Challenge

hv20-ball01 HV20.01 Happy HACKvent 2020
Categories: forensicFORENSIC
Level: easy
Author: mij-the-dj

Welcome to this year’s HACKvent.

Attached you can find the “Official” invitation to the HackVent.

letter

</picture>

One of my very young Cyber Elves cut some parts of the card with his alpha scissors.

Have a great HACKvent,

– Santa

Solution

I’ll show three ways to solve, using StegSolve, Gimp, and Python.

StegSolve

On seeing the image, along with the mention of messing with alpha, which is a channel in an image, and immediately I loaded the file in Stegsolve.

The first transform is Color Inversion (XOR) pops the flag right out:

image-20201130182716637

A bunch of the other filters solve it as well.

Gimp

To really see what’s going on, I’ll open the image in Gimp, and also open the Pointer dialog from Windows –> Dockable Dialogs –> Pointer. This will show information about whatever pixel my cursor is currently over:

image-20201201093713232

Gimp shows the image with transparency boxes over where I’d expect the flag to be:

image-20201201093812987

Moving the cursor around the picture, the alpha value is set to 255 everywhere except in those boxes, where it’s 0. The alpha channel represents the transparency or opacity of the color at that pixel, where 0 is completely transparent and 255 is full opacity. Because the sections with the flag are fully transparent, it isn’t possible to read their values.

Selecting the eraser tool, setting the Opacity to 100, and dragging it over the checkerboard boxes removes the transparency, leaving the flag:

image-20201201094348715

Python

To solve this with Python, I can open the image using Pillow, and just edit the alpha channel to 255 for each pixel. This post gives a good intro on editing an image. I’ll open it, convert to to RGBA (to include the Alpha channel), and then loop over the pixels, for each setting Alpha to 255:

#!/usr/bin/env python3

from PIL import Image


image = Image.open("7c432457-ed44-4ebe-84bf-cb6966e7a3dc.png").convert('RGBA')
pixels = image.load()

for i in range(image.width):
    for j in range(image.height):
        pixel = pixels[i, j]
        pixels[i, j] = (pixel[0], pixel[1], pixel[2], 255)

image.save("no_alpha.png")

The resulting image has the flag:

Flag: HV20{7vxFXB-ItHnqf-PuGNqZ}

HV20.02

Challenge

hv20-ball02 HV20.02 Chinese Animals
Categories: funFUN
Level: easy
Author: The Compiler

I’ve received this note from a friend, who is a Chinese CTF player:

恭喜!收旗爲:HV20{獭慬氭敬敧慮琭扵瑴敲晬礭汯癥猭杲慳猭浵搭桯牳e}

Unfortunately, Google Translate wasn’t of much help:

</picture>

</picture>

I suspect the data has somehow been messed up while transmitting it.

Sadly, I can’t ask my friend about more details. The Great Chinese Firewall is thwarting our attempts to reach each other, and there’s no way I’m going to install WeChat on my phone.

Solution

Flag

The solution is pretty easy to come by, playing around with different encodings with iconv or in cyberchef dumps the flag when the data is converted to UTF-16:

$ echo "獭慬氭敬敧慮琭扵瑴敲晬礭汯癥猭杲慳猭浵搭桯牳" | iconv --to-code=utf-16be
small-elegant-butterfly-loves-grass-mud-hors
image-20201202072229728

So the flag is:

Flag: HV20{small-elegant-butterfly-loves-grass-mud-horse}

Why?

I spent way longer looking at why this worked than actually solving the challenge. This post is a really good primer on how Unicode works.

I started off by looking at the input and output lengths:

$ echo -n "獭慬氭敬敧慮琭扵瑴敲晬礭汯癥猭杲慳猭浵搭桯牳" | xxd
00000000: e78d ade6 85ac e6b0 ade6 95ac e695 a7e6  ................
00000010: 85ae e790 ade6 89b5 e791 b4e6 95b2 e699  ................
00000020: ace7 a4ad e6b1 afe7 99a5 e78c ade6 9db2  ................
00000030: e685 b3e7 8cad e6b5 b5e6 90ad e6a1 afe7  ................
00000040: 89b3                                     ..
$ echo -n "獭慬氭敬敧慮琭扵瑴敲晬礭汯癥猭杲慳猭浵搭桯牳" | iconv --to-code=utf-16be | xxd
00000000: 736d 616c 6c2d 656c 6567 616e 742d 6275  small-elegant-bu
00000010: 7474 6572 666c 792d 6c6f 7665 732d 6772  tterfly-loves-gr
00000020: 6173 732d 6d75 642d 686f 7273            ass-mud-hors

The raw input is 66 bytes, whereas the output is 44 bytes. Just counting the Chinese characters shows 22 characters. This implies that each Chinese characters is three bytes, and that each is converted to two bytes of ascii. And looking at a single character, that seems to be right:

$ echo -n "獭" | xxd
00000000: e78d ad                                  ...
$ echo -n "獭" | iconv --to-code=utf-16be | xxd
00000000: 736d                                     sm

So the question that remains is how does 0xe78dad become 0x736d?

This page about the otter character shows that I’m on the right track in how I’m thinking about this:

image-20201202073414638

UTF encodings are quite complicated. UTF-8 can have between 1 and 4 bytes per character. For characters up to 0xFFFF, they map 1:1 to UTF-16 characters (which are typically two bytes). But once it goes above that, the mapping is no longer so transparent.

This code in C from GitHub reads in UTF-8 characters and translates them in to UTF-16. It starts by reading in on character. If the top bit is 0, then it converts that to 16 bits (0 filling the top), and prints it. Otherwise, based on the high bits, it can tell if the character is two, three, or four bytes. It reads in the right number, does some math, and outputs the result.

For this case, all of the characters start with 1110, which indicates a three-byte character. Looking in the hex dump of the input above, you’ll notice that every third character starts with hex e.

To convert to UTF-16 from UTF-8, I’ll take the low four bits from the first character, the low six bits from the next two, and put them together, like this in Python:

>>> c1 = 0xe7; c2 = 0x8d; c3 = 0xad
>>> f'{c1 & 0xf:04b}'
'0111'
>>> f'{c2 & 0x3f:06b}'
'001101'
>>> f'{c3 & 0x3f:06b}'
'101101'
>>> f'{c1 & 0xf:04b}{c2 & 0x3f:06b}{c3 & 0x3f:06b}' 
'0111001101101101'
>>> hex(int(f'{c1 & 0xf:04b}{c2 & 0x3f:06b}{c3 & 0x3f:06b}', 2))
'0x736d'

It could also be expressed as:

>>> hex(((c1 & 0xf) << 12) | ((c2 & 0x3f) << 6) | (c3 & 0x3f))
'0x736d'

Interestingly, in Python, ord will also convert a character to it’s raw code, which happens to be the two bytes used for UTF-16:

>>> hex(ord('獭'))
'0x736d'

So this challenge could also be solved with a one-liner using list comprehension, ord, and binascii:

>>> binascii.unhexlify(''.join([hex(ord(c))[2:] for c in '獭慬氭敬敧慮琭扵瑴敲晬礭汯癥猭杲慳猭浵搭桯牳']))
b'small-elegant-butterfly-loves-grass-mud-hors'

HV20.03

Challenge

hv20-ball03 HV20.03 Packed gifts
Categories: cryptoCRYPTO
Level: easy
Author: darkstar

One of the elves has unfortunately added a password to the last presents delivery and we cannot open it. The elf has taken a few days off after all the stress of the last weeks and is not available. Can you open the package for us?

We found the following packages:

The two files are both zip archives:

$ file *.zip
790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip: Zip archive data, at least v?[0x314] to extract
941fdd96-3585-4fca-a2dd-e8add81f24a1.zip: Zip archive data, at least v?[0x314] to extract

Solution

Examine the Zips

The first package contains 100 files, all the same size, same timestamp:

$ unzip -l 790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip
Archive:  790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip
  Length      Date    Time    Name    
---------  ---------- -----   ----    
      172  2020-11-24 09:07   0000.bin
      172  2020-11-24 09:07   0001.bin
      172  2020-11-24 09:07   0002.bin
      172  2020-11-24 09:07   0003.bin
      172  2020-11-24 09:07   0004.bin
...[snip]...
      172  2020-11-24 09:07   0097.bin
      172  2020-11-24 09:07   0098.bin
      172  2020-11-24 09:07   0099.bin
---------                     -------
    17200                     100 files

The second looks exactly the same, but there’s one extra file, flag.bin:

$ unzip -l 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip                                         
Archive:  941fdd96-3585-4fca-a2dd-e8add81f24a1.zip
  Length      Date    Time    Name    
---------  ---------- -----   ----    
      172  2020-11-24 09:07   0000.bin 
      172  2020-11-24 09:07   0001.bin
      172  2020-11-24 09:07   0002.bin
      172  2020-11-24 09:07   0003.bin
      172  2020-11-24 09:07   0004.bin
...[snip]...
      172  2020-11-24 09:07   0097.bin
      172  2020-11-24 09:07   0098.bin
      172  2020-11-24 09:07   0099.bin
      172  2020-11-24 09:25   flag.bin
---------                     -------
    17372                     101 files

The first will unzip, and I can look at the contents of the files. They each contain a single 172 character base64-encoded string, and they each decode to what looks like random garbage.

The second archive is encrypted with a password.

Known Plaintext - Fail

The challenge is screaming known plaintext attack. Some googling for “known plaintext zip” led to some academic papers as well as a tool bkcrack. This tool takes two zips, one encrypted and the other not, as well as the names of files in each zip that are the same content. It then generates the encryption keys needed to pull files from the password protected archive.

I originally assumed that all the bin files were the same, and gave it a run:

$ ./bkcrack -C 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip  -c 0000.bin -P 790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip -p 0000.bin
bkcrack 1.0.0 - 2020-11-11
Generated 4194304 Z values.                                                                                          
[21:02:13] Z reduction using 151 bytes of known plaintext
100.0 % (151 / 151)
54497 values remaining.
[21:02:14] Attack on 54497 Z values at index 8
100.0 % (54497 / 54497)
[21:05:32] Could not find the keys.

It ran for a few minutes and failed.

Find Same File

Eventually it is worth questioning the assumption that all the files with the same names were the same. To check, I looked at the CRCs for each file in each archive. Zip archives store the CRC of the plaintext file, even for encrypted archives. That means if the files are the same, the CRCs should match.

I wrote a short Python script to check each file in the encrypted archive and see if the file with the same name in the unencrypted archive had the same CRC:

#!/usr/bin/env python3

from zipfile import ZipFile


crcs = {}

with ZipFile('790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip', 'r') as arc:
    for meta in arc.infolist():
        crcs[meta.filename] = meta.CRC


with ZipFile('941fdd96-3585-4fca-a2dd-e8add81f24a1.zip', 'r') as arc:
    for meta in arc.infolist():
        if meta.filename in crcs and crcs[meta.filename] == meta.CRC:
            print(meta.filename)

It turns out that only one file had a matching CRC:

$ python3 check_CRCs.py 
0053.bin

In talking with a friend after the challenge, he mentioned using zip2john to get the CRCs and manually compare. I wanted to see if I could turn that into a Bash one-liner. I had all the .bin files from the first package in a folder, so I’ll use crc32 to calculate their CRCs, and after some formatting, use those as a file of grep inputs on the zip2john output to find the file:

$ zip2john 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip 2>&1 | grep -f <(crc32 package1/*.bin | awk '{print $1}' | tr '[:lower:]' '[:upper:]')
ver 78.8 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip/0053.bin PKZIP Encr: cmplen=171, decmplen=172, crc=FCD6B08A

This breaks down to:

  • zip2john [encrypted zip] 2>&1 - generate hashes and information for each file in the archive, including the CRC.
  • <(crc32 package1/*.bin | awk '{print $1}' | tr '[:lower:]' '[:upper:]') - generate CRCs for each of the unzipped files, isolating them one per line, and making the letters upper case (to match zip2john output); the <( ) will have the terminal treat the output as the contents of a file.
  • grep -f [file] - grep for any lines that contain any of the values in the given file, which in this case is the CRC values.

bkcrack

I’ll re-run bkcrack this time using 0053.bin, and it finds the keys:

$ bkcrack-1.0.0-Linux/bkcrack -C 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip  -c 0053.bin -P 790ccd6f-cd84-452c-8bee-7aae5dfe2610.zip -p 0053.bin                                                                    
bkcrack 1.0.0 - 2020-11-11
Generated 4194304 Z values.
[21:54:02] Z reduction using 151 bytes of known plaintext
100.0 % (151 / 151)
53880 values remaining.
[21:54:04] Attack on 53880 Z values at index 7
Keys: 2445b967 cfb14967 dceb769b
68.8 % (37074 / 53880)
[21:56:07] Keys
2445b967 cfb14967 dceb769b   

I can use those keys to pull flag.bin from the encrypted zip:

$ bkcrack-1.0.0-Linux/bkcrack -c flag.bin -d flag.bin -C 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip -k 2445b967 cfb14967 dceb769b
bkcrack 1.0.0 - 2020-11-11
Wrote deciphered text.

The resulting file is still compressed, and I’ll use the inflate.py script from the same repo to decompress it, and grab the flag:

$ python3 bkcrack-1.0.0-Linux/tools/inflate.py < flag.bin > flag.txt
$ cat flag.txt
SFYyMHtaaXBDcnlwdDBfdzF0aF9rbjB3bl9wbGExbnRleHRfMXNfZWFzeV90MF9kZWNyeXB0fSAgICAgICAgICAgICAgICAgSFYyMHtaaXBDcnlwdDBfdzF0aF9rbjB3bl9wbGExbnRleHRfMXNfZWFzeV90MF9kZWNyeXB0fQo=
$ cat flag.txt | base64 -d
HV20{ZipCrypt0_w1th_kn0wn_pla1ntext_1s_easy_t0_decrypt}                 HV20{ZipCrypt0_w1th_kn0wn_pla1ntext_1s_easy_t0_decrypt}

Flag: HV20{ZipCrypt0_w1th_kn0wn_pla1ntext_1s_easy_t0_decrypt}

HV20.H1

Challenge

hv20-ballH1 HV20.H1 It's a secret
Categories: hiddenHIDDEN
Level: easy
Author: darkstar

This appeared with HV20.03:

Who knows where this could be hidden… Only the best of the best shall find it!

We hide additional flags in some of the challenges! This is the place to submit them. There is no time limit for secret flags.

Solution

Typically when the hidden challenges appear with a specific challenge, it’s a good idea to dig further into that challenge. I had already run a loop over all the .bin files in the unencrypted archive seeing if there were any clues in the base64 decoded data. Now I turned to the encrypted zip.

I used the following loop to pull all the files from the encrypted archive (using my directory with the bin files from the other package to get the names):

for f in $(ls package1/); do bkcrack-1.0.0-Linux/bkcrack -C 941fdd96-3585-4fca-a2dd-e8add81f24a1.zip -k 2445b967 cfb14967 dceb769b -c $f -d package2/$f; done

Next I needed to inflate them all:

for f in $(ls package1/); do bkcrack-1.0.0-Linux/tools/inflate.py < package2/$f > package2/${f}.inf; done

Now I’ll loop over each file, base64 decoding, and grepping for a flag (and printing the filename if the grep matches):

$ for f in $(ls package2/*.inf); do cat ${f} | base64 -d | grep -a HV20 && echo $f; done
FU>>>>   HV20{it_is_always_worth_checking_everywhere_and_congratulations,_you_have_found_a_hidden_flag}   <<<<iaO^7
package2/0042.bin.inf

It’s located in file number 42, the Answer to the Ultimate Question of Life, the Universe, and Everything.

Flag: HV20{it_is_always_worth_checking_everywhere_and_congratulations,_you_have_found_a_hidden_flag}

HV20.04

Challenge

hv20-ball04 HV20.04 Br❤️celet
Categories: funFUN
Level: easy
Author: brp64

Santa was given a nice bracelet by one of his elves. Little does he know that the secret admirer has hidden a message in the pattern of the bracelet…

img

</picture>

Over the 24 hours after release, Hackvent added five hints:

  1. No internet is required - only the bracelet
  2. The message is encoded in binary
  3. Violet color is the delimiter
  4. Colors have a fixed order
  5. Missing colors matter

Solution - Fail

I (along with everyone else) spent a long time flailing on this one before they issued hints. My best guess was to look at the five bead colors as a kind of base5 digit set. The challenge there is that how to assign each bead a value from 0-4. I wrote a Python script to brute force that:

#!/usr/bin/env python3

import binascii
from itertools import permutations

s = 'vpyvgbvpgvgbvpgbyvgbyvgbvbyvbyvgbyvpyvbyvvgbyvgyvgyvbyvbyvgvgbvpgbvbyvgbyvbyvgv'

chars = sorted(set(s))

for perm in permutations(range(len(chars))):
    num = int(''.join([f'{perm[chars.index(c)]}' for c in s]), 5)
    h = f'{num:x}'
    print(h)
    try:
        asc = binascii.unhexlify(h)
        if sum(x < 128 for x in asc) > 10 or True:
            print(asc)
    except binascii.Error:
        pass

I’m going to loop over all permutations of 0-4, to get all possible color mappings. For each one, I create a string and convert it to an int base5. Then I convert to hex and unhexlify it, printing the result if there’s more than 10 characters in the ASCII range.

This produced no results.

Solution

Eventually Hackvent added five hints. When I woke up, there were three:

No internet is required - only the bracelet The message is encoded in binary Violet color is the delimiter

Using violet as a delimiter was what tipped me off. Looking at the result when I replace v with space, the fact that the colors are always in the same order jumps out at me:

>>> s.replace('v', ' ')
' py gb pg gb pgby gby gb by by gby py by  gby gy gy by by g gb pgb by gby by g '

Pink, green, blue, yellow. If I look at those as bits that are present or not present, then each section between the spaces is nibble (4 bits).

I wrote a script to find the flag:

#!/usr/bin/env python3

import binascii


s = 'gvpyvgbvpgvgbvpgbyvgbyvgbvbyvbyvgbyvpyvbyvvgbyvgyvgyvbyvbyvgvgbvpgbvbyvgbyvbyvgv'
key = {'p': 8, 'g': 4, 'b': 2, 'y': 1}

hex_res = ''

for nibble in s[:-1].split('v'):
    hex_res += f'{sum([key[c] for c in nibble]):x}'
    
print('HV20{' + binascii.unhexlify(hex_res).decode() + '}')

I started with the idea that p would be the highest value since it came first, but had that not worked, I would have next tried the opposite order (p = 1, y = 8), and if that failed, then tried a brute force over all orderings.

It did work on this first order:

$ python3 solve.py 
HV20{Ilov3y0uS4n74}

Flag: HV20{Ilov3y0uS4n74}

HV20.05

Challenge

hv20-ball05 HV20.05 Image DNA
Categories: cryptoCRYPTO
forensicFORENSIC
Level: easy
Author: blaknyte0

Santa has thousands of Christmas balls in stock. They all look the same, but he can still tell them apart. Can you see the difference? img

</picture> img

Fails

I tried a handful of things that didn’t work. I was keyed in on the word difference, so I tried opening the files in Gimp and subtracting them and other ways of combining them (kind of like HV19.09) , but just got pictures like:

image-20201218145933012 image-20201218145912187

I also wrote a Python script to do a pixel by pixel comparison. But there were over 22-thousand different pixels, which was too much to turn into a code of some sort.

Solution

To solve this, I needed to find two strings, and there were two clues available.

The strings literally strings in the image file:

$ strings 6bbc452b-6a32-4a72-b74f-07b7ad7b181d.jpg
...[snip]...
CTGTCGCGAGCGGATACATTCAAACAATCCTGGGTACAAAGAATAAAACCTGGGCAATAATTCACCCAAACAAGGAAAGTAGCGAAAAAGTTCCAGAGGCCAAA
$ strings cf505372-330b-4b34-a95b-59fa33db37f8.jpg
...[snip]...
ATATATAAACCAGTTAATCAATATCTCTATATGCTTATATGTCTCGTCCGTCTACGCACCTAATATAACGTCCATGCGTCACCCCTAGACTAATTACCTCATTC

Without any hints, I could guess this is a base-4 number system and try to decode, but there were two hints.

Running binwalk against one of the images shows there’s a small zip archive attached to the end:

$ binwalk cf505372-330b-4b34-a95b-59fa33db37f8.jpg 

DECIMAL       HEXADECIMAL     DESCRIPTION
--------------------------------------------------------------------------------
0             0x0             JPEG image data, JFIF standard 1.01
8723          0x2213          Zip archive data, at least v2.0 to extract, uncompressed size: 3, name: A
8886          0x22B6          End of Zip archive, footer length: 22

Extracting that file (using the -e option in binwalk) shows it’s a zip with one file, named A, with the contents 00.

The other image has an embedded in it with a common CTF tool, steghide, using no password. I’ll use steghide to extract an image:

$ steghide extract -sf 6bbc452b-6a32-4a72-b74f-07b7ad7b181d.jpg 
Enter passphrase: 
wrote extracted data to "T.png".

The image is tiny, containing only two digits:

Now I’ll take the two strings, and the two hints at what the values will be, and the knowledge that the flag will start with HV or 01 00 10 00 01 01 01 10. Both strings had T at index 1 and 3, and it should be 00 in those places. I looked at subtracting the strings, but that got complex with negatives. Then I looked at xor, and that was promising:

CTGT --> ?? 11 ?? 11
ATAT --> 00 11 00 11
         -----------
want     01 00 10 00         

To get 01 00 10 00, let C = 01 and G = 10, making an ASCII H. To check, look at the second letter, V:

CGCG --> 01 10 01 10
ATAA --> 00 11 00 00
         -----------
         01 01 01 10 == V

It works. Python can convert the rest:

#!/usr/bin/env python3

import binascii

str1 = "CTGTCGCGAGCGGATACATTCAAACAATCCTGGGTACAAAGAATAAAACCTGGGCAATAATTCACCCAAACAAGGAAAGTAGCGAAAAAGTTCCAGAGGCCAAA"
str2 = "ATATATAAACCAGTTAATCAATATCTCTATATGCTTATATGTCTCGTCCGTCTACGCACCTAATATAACGTCCATGCGTCACCCCTAGACTAATTACCTCATTC"

codes = {"A": 0, "C": 1, "G": 2, "T": 3}

res = ""
for x, y in zip(str1, str2):
    diff = codes[x] ^ codes[y]
    res += f"{diff:02b}"

print(binascii.unhexlify(f"{int(res, 2):x}").decode())

That prints the full flag:

$ python3 solve.py 
HV20{s4m3s4m3bu7diff3r3nt}

Flag: HV20{s4m3s4m3bu7diff3r3nt}